معلومة

Wolbachia - عدم توافق السيتوبلازم


قرأت أن عدم التوافق السيتوبلازمي في Wolbachia يحدث عندما تتزاوج الحشرات الذكور المصابة بالبكتيريا مع حشرات أنثى خالية من الولبخية وتنتج ذرية غير قابلة للحياة. على النقيض من ذلك ، فإن العوائل المصابة بالبكتيريا wolbachia تنتج ذرية ناجحة بغض النظر عن حالة العدوى لشريكها.

كنت أتساءل - ما هي الآثار طويلة المدى لهذا على حجم / هيكل مجموعة الحشرات؟ كيف سيكون هذا مختلفًا عن السكان غير المصابين؟


Wolbachia التنوع وأنماط عدم التوافق السيتوبلازمي في كوليكس بيبيينز السكان في تركيا

Wolbachia هي بكتيريا تنتقل عن طريق الأم ويمكنها التلاعب بتكاثر مضيفها مما يتسبب في عدم توافق السيتوبلازم (CI). CI هو عدم توافق الحيوانات المنوية والبويضة مما يؤدي إلى موت الجنين. بسبب هذا التأثير المعقم للبعوض ، Wolbachia تعتبر لاستراتيجيات مكافحة ناقلات الأمراض. نواقل مهمة للفيروسات المنقولة بالاتصال الجنسي ، والديدان الخيطية الفيلارية ، وملاريا الطيور ، وناموس البعوض. كوليكس بيبيينز مجمع مناسبة ل ولباتشيا-مكافحة ناقلات على أساس. هم مصابون Wolbachia دبليوسلالات Pip تنتمي إلى خمس مجموعات متميزة وراثيًا (ثPip-I إلى V) داخل Wolbachia مجموعة B الفائقة. خصائص CI ثترتبط النقطة ارتباطًا وثيقًا بهذا التنوع الجيني: البعوض المصاب ثسلالات Pip من ملف مختلف ثمن المرجح أن تكون مجموعة Pip غير متوافقة مع بعضها البعض. تعتبر تركيا بقعة حرجة للأمراض المنقولة بالنواقل بسبب موقعها الجغرافي الفريد كجسر طبيعي بين آسيا وأوروبا وأفريقيا. ومع ذلك ، عامة ثتنوع الأنابيب والتوزيع وأنماط CI في الطبيعة Cx. بيبيينز (س.ل.) السكان في المنطقة غير معروفين. في هذه الدراسة ، حددنا أولاً ثتنوع النقطة في التركية Cx. بيبيينز (س.ل.) السكان, من خلال تخصيصها لإحدى المجموعات الخمس الموجودة داخلها ثنقطة (ثبيب إيتو الخامس). لقد حققنا كذلك في خصائص CI بين مختلف ثسلالات الأنابيب من هذه المنطقة.

نتائج

أظهرنا أ ثتثبيت الأنابيب في Cx. بيبيينز (س.ل.) السكان في تركيا من خلال تحليل 753 عينة من 59 موقعًا لأخذ العينات. ثلاثة ثتم اكتشاف مجموعات Pip في المنطقة: ثPip-I، دبليوPip-II و ثالنقطة الرابعة. كانت المجموعة الأكثر هيمنة ثالنقطة الثانية. في حين ثتم حصر Pip-IV في موقعين فقط ، ثPip-I و ثكان Pip-II توزيعات أوسع. الأفراد المصابون ثتم العثور على Pip-II متعايشة مع الأفراد المصابين ثPip-I أو ثPip-IV في بعض مواقع أخذ العينات. اثنين من البعوض هو سلالات أنثوية تؤوي إما أ ثPip-I أو أ ثتم إنشاء سلالة Pip-II من مجموعة سكانية في شمال غرب تركيا. أظهرت التقاطعات المتبادلة بين هذه الخطوط أنها كانت متوافقة تمامًا مع بعضها البعض ولكنها غير متوافقة معها بشكل ثنائي الاتجاه ثخط Pip-IV اسطنبول المصاب.

استنتاج

النتائج التي توصلنا إليها تكشف عن تنوع كبير في ثخصائص Pip و CI بتنسيق Cx. بيبيينز (س.ل.) السكان في تركيا. المعرفة بأنماط CI التي تحدث بشكل طبيعي الناتجة عن ثقد يكون تنوع الأنابيب في تركيا مفيدًا Cx. بيبيينز (س.ل.) السيطرة في المنطقة.


عدوى بكتيريا Wolbachia وعدم توافق السيتوبلازم في أنواع ذبابة الفاكهة

تم مسح واحد وأربعين مخزونًا من 30 نوعًا من ذبابة الفاكهة بحثًا عن عدوى Wolbachia باستخدام تقنية PCR. تم العثور على D. sechellia واثنين من سلالات D. auraria مصابة وتم اختبارها للتعبير عن عدم توافق السيتوبلازم ، جنبًا إلى جنب مع سلالات D. ananassae و D. melanogaster ، والتي من المعروف أنها مصابة بالفعل. تظهر D. ananassae و D. melanogaster مستويات من عدم التوافق تصل إلى 25٪ ، بينما تظهر D. auraria و D. sechellia مستويات موت البيض تقريبًا 60٪. تم تطوير اختبار dot-blot باستخدام تسلسل dnaA كمسبار لتقييم مستويات العدوى في الذكور الفردية التي تم استخدامها في تقاطعات عدم التوافق. لوحظ وجود علاقة إيجابية بين الكثافة البكتيرية وعدم توافق السيتوبلازم. يمكن تجميع المخزونات التي تم فحصها في مجموعتين على الأقل ، اعتمادًا على مستويات العدوى بالنسبة لدرجة عدم التوافق السيتوبلازمي الظاهرة. مجموعة واحدة ، تحتوي على D. simulans Hawaii ، D. Sechellia ، و D. auraria ، تُظهر مستويات عالية من عدم توافق السيتوبلازم بالنسبة لمستويات الإصابة بجميع الأنواع الأخرى و D. . تظهر هذه البيانات أنه بالإضافة إلى الكثافة البكتيرية ، تؤثر العوامل البكتيرية و / أو المضيفة أيضًا على التعبير عن عدم توافق السيتوبلازم.


على آلية Wolbachia- عدم التوافق السيتوبلازمي الناجم: مواجهة النماذج بالحقائق

البكتيريا الداخلية Wolbachia تتلاعب بتكاثر مضيفيها من المفصليات لمصلحتها الخاصة بوسائل مختلفة ، وأكثرها انتشارًا هو عدم التوافق السيتوبلازمي (CI). حتى الآن ، لم يتم توضيح الآلية الجزيئية المشاركة في CI. ندرس هنا ثلاثة نماذج مختلفة من CI موصوفة في الأدبيات السابقة ، وهي نماذج "القفل والمفتاح" و "المعايرة - الاستعادة" و "الحركة البطيئة". نواجههم بمجموعة كاملة من أنماط CI المكتشفة حتى الآن ، بما في ذلك أكثرها تعقيدًا مثل العدوى المتعددة ، وعلاقات التوافق غير المتكافئة والجزئية ووجود Wolbachia المتغيرات التي يمكن أن تنقذ المضيف من CI ولكن لا تحفزه. نستنتج أن نموذج القفل والمفتاح هو الأكثر شحًا في النماذج ويناسب الملاحظات بشكل أفضل. لا يمكن إبطال النموذجين الآخرين بشكل قاطع ، لكنهما يواجهان بعض الصعوبات التي تجعل فرضيات إضافية ضرورية. BioEssays 25: 259–265، 2003. © 2003 Wiley Periodicals، Inc.


المواد والأساليب

دراسة الأنواع

تم التحقيق في تأثير عمر الذكور ومعدل التزاوج على تحريض CI ونقل الحيوانات المنوية في D. simulans. الذباب المصاب ب وولباتشيا ريفرسايد أضنى (wRi) تم جمعها في الأصل من ريفرسايد ، كاليفورنيا (الولايات المتحدة الأمريكية) ، وتم الاحتفاظ بها في أعداد كبيرة من المختبرات منذ عام 2003 (تم الحصول عليها من G. Hurst ، UCL ، والتي نشأت من سلالة Riverside ‘89 كما هو موضح في Hoffmann وآخرون. ، 1990). تم الحصول على الذباب غير المصاب عن طريق العلاج بالمضادات الحيوية (tetracycline hydrochloride) لأعداد كبيرة من الذباب المصاب قبل عامين على الأقل من التجربة. تعني الأعداد الكبيرة من الأفراد المشاركين في عملية القضاء على العدوى أنه من غير المحتمل أن يعاني السكان غير المصابين من اكتئاب زواج الأقارب أو يختلفون في الخلفية الوراثية عن السكان المصابين. وبالتالي ، من المحتمل أن تكون أي اختلافات بين السكان المصابين وغير المصابين بسبب وجود / عدم وجود Wolbachia. تم الحفاظ على كل من السكان المصابين وغير المصابين في نفس الظروف عند 25 درجة مئوية في دورة ضوئية / مظلمة مدتها 12: 12 ساعة مع إمداد ثابت من الطعام ووسط لوضع البيض عليه.

تم تأكيد حالة إصابة الذباب من كل من السكان المصابين وغير المصابين عن طريق تفاعل البلمرة المتسلسل (PCR). عالمي Wolbachia- تم استخدام مواد أولية محددة (Wsp 81F و Wsp 691R). تم تأكيد حالة العدوى قبل وبعد التجربة باستخدام الإجراء كما هو موضح في Champion De Crespigny وآخرون. (2006). تم تأكيد حالة الإصابة المتوقعة في جميع الحالات.

جمع البيض واليرقات

تم جمع البيض من المخزونات عن طريق إدخال أطباق بتري صغيرة تحتوي على وسط معياري لوضع البيض (12.5 جم من الاغاروز ، 275 مل من الماء منزوع الأيونات ، 150 مل من عصير العنب و 0.5 جم من Nipagin) و 0.5 جم من معجون الخميرة في أقفاص العشائر. تم التحكم في كمية الخميرة في حالة تأثير ذلك على تكوين الحيوانات المنوية عند الذكور. تم جمع البيض كل 24 ساعة لمدة 8 أيام متتالية. تم جمع اليرقات في الصباح باستخدام مؤشر معدني ووضعها في قوارير تحتوي على 15 مل من ذبابة الفاكهة واسطة. تم تربيتها على الخميرة المنخفضة القياسية ذبابة الفاكهة متوسط ​​(10 جم agarose ، 20 جم خميرة ، 85 جم سكر حبيبي ، 60 جم ​​ذرة ، 1000 مل ماء منزوع الأيونات و 1 جم نيبجين). تم وضع 25 يرقة فردية فقط في كل قنينة من أجل التحكم في كثافة اليرقات والتأكد من أن اليرقات لديها بالشهرة الإعلانية الغذاء أثناء عملية التربية. تم تربية الذباب في دورة مظلمة / مظلمة 12: 12 ساعة. تم جمع ما يقرب من 500 يرقة من كل حالة إصابة يوميا.

جمع الكبار والتحديد الجنسي

بعد حوالي 8-9 أيام من وضع البيض ، بدأ البالغون في الانسداد. تم فحص القوارير كل 6 ساعات (ثلاث مرات خلال دورة الضوء) للذباب المغلق حديثًا. تم تبريد البالغين الجدد على الجليد ، وتمييز الجنس ، ووضع الجنسين في قوارير منفصلة تحتوي على ذبابة الفاكهة متوسطة مع 40 فردًا لكل قارورة. ضمنت هذه العملية أن جميع الذباب البالغ كانوا عذارى في بداية التجربة. تم الاحتفاظ بالذباب من الذكور والإناث عند 25 درجة مئوية في دورة 12: 12 ساعة فاتحة / مظلمة.

تجربة CI CI التعريفي

من أجل دراسة تأثير تاريخ التزاوج وعمر الذكور على تحريض CI ، تم التلاعب بمعدل التزاوج الذكور وتاريخ التزاوج بعناية. لاستكشاف تأثير معدل التزاوج على CI ولتمييز تأثير معدل التزاوج من تأثير الشيخوخة ، تم استخدام ثلاثة معالجات مختلفة. أولاً ، للتحكم في تأثير عمر الذكور على تحريض غشاء العظم ، تم تزاوج الذكور المصابة بالعذراء الذين تتراوح أعمارهم بين 5 و 6 و 7 و 8 أو 11 يومًا لإناث عذراء غير مصابة وسجل نجاح CI / الفقس (انظر أدناه للحصول على الإجراء وكذلك الجدول 1 ) (تزاوج واحد فقط لكل ذكر في عمر محدد). يشار إلى هذا العلاج باسم "التحكم في الشيخوخة - SC". تحت العلاج الثاني - معدل تزاوج منخفض (LMR) ، تزاوج الذكور مع أنثى عذراء واحدة غير مصابة عندما كان عمرهم 4 و 5 و 6 و 7 و 8 و 11 يومًا على التوالي (6 مرات تزاوج في المجموع لكل ذكر فردي) ، و تم تسجيل نجاح CI / الفقس لكل من هذه التزاوجات (انظر أدناه). في العلاج النهائي - معدل التزاوج المرتفع (HMR) ، تم تزاوج الذكور مع ثلاث إناث عذراء غير مصابات عندما كانت في سن 4 و 5 و 6 و 7 و 8 وتزاوج واحد عندما كان عمرهم 11 يومًا (إجمالي 16 نضجًا لكل ذكر فردي) ). تم استخدام الأنثى الأولى التي تزاوج معها ذكر HMR كل يوم لتحقيق نجاح CI / الفقس.

العلاجات ذكور حجم العينة تاريخ التزاوج للذكور
شيخوخة الذكور مصاب 15 لكل عمر ذكر عذراء وتزاوج واحد في اليوم
غير مصاب 15 لكل عمر ذكر عذراء وتزاوج واحد في اليوم
معدل تزاوج منخفض مصاب 20 6 مرات في المجموع لكل ذكر
غير مصاب 20 6 مرات في المجموع لكل ذكر
ارتفاع معدل التزاوج مصاب 25 16 نضجًا في المجموع لكل ذكر
غير مصاب 25 16 نضجًا في المجموع لكل ذكر

في بداية التجربة ، تم وضع ذكور يبلغ من العمر 3 أيام في قوارير تزاوج 7.5 × 2.5 سم (ذكر واحد / قارورة). تم تقسيمهم إلى علاجات SC و LMR و HMR بشكل عشوائي مع حجم عينة من 15 و 20 و 25 ذبابة على التوالي. بالنسبة لعلاج SC ، كان حجم العينة 15 ذكرًا من كل عمر فردي. تمت إضافة ذبابة عذراء واحدة غير مصابة (عمرها 4-5 أيام) إلى كل قنينة في بداية التزاوج كل يوم (وفقًا للمعالجة) وتمت إزالتها بعد اكتمال الجماع. سجلنا الوقت الذي بدأ فيه الذكور التزاوج (TSM) والوقت الذي انتهى فيه الذكور من التزاوج (TFM). بمجرد انتهاء التزاوج ، تم نقل إناث الذباب إلى خميرة ملونة منخفضة ذبابة الفاكهة متوسطة إلى بيضوي. تم تحضين البيض لمدة 24 ساعة عند 25 درجة مئوية في دورة مظلمة / فاتحة 12: 12 ساعة. بعد 24 ساعة ، تمت إزالة الإناث TFM وتجميدها وتأكيد حالة العدوى للإناث لاحقًا بواسطة تفاعل البوليميراز المتسلسل. تم حساب البيض الذي وضعته الإناث في 24 ساعة بعد التزاوج مرتين: 48 و 72 ساعة بعد TFM. ومع ذلك ، في 72 ساعة ، تم حساب البيض غير المقشور فقط.

يُطلق على النسبة المئوية لجميع البيض الذي تضعه كل أنثى على حدة خلال فترة 24 ساعة بعد التزاوج الذي يفقس لاحقًا ، نجاح الفقس. تم استخدام نسبة نجاح الفقس كمقياس لتعبير CI. سيؤدي تعبير CI الكامل إلى نجاح تفقيس 0٪. الزيادة في النسبة المئوية للبيض الذي فقس يعني انخفاض التعبير CI واستعادة التوافق التناسلي. وبالتالي ، يرتبط CI ارتباطًا سلبيًا بنجاح الفقس.

تجربة نقل الحيوانات المنوية

العلاجات وإجراءات التزاوج

تم استخدام ثلاث علاجات مصابة وثلاث معالجات غير مصابة (الجدول 1) للتحقيق في آثار حالة العدوى وعمر الذكور ومعدل التزاوج على عدد الحيوانات المنوية المنقولة إلى أنثى عند الجماع. في جميع الحالات ، كانت الإناث غير مصابات Wolbachia. تم تخصيص الذكور المصابين وغير المصابين بشكل عشوائي لعلاجات SC و LMR و HMR (وفقًا لتجربة تحريض CI الموصوفة سابقًا) (الجدول 1) بأحجام عينة من 15 و 20 و 25 ذبابة لكل علاج ، على التوالي. تم استخدام ذكور 4 و 5 و 6 و 7 و 8 و 11 يومًا وإناثًا غير مصابة من 4-5 أيام على غرار تجربة تحريض CI. في بداية كل يوم من أيام التجربة ، تمت إضافة أنثى واحدة إلى قارورة كل ذكر. تم تسجيل TSM و TFM. بمجرد انتهاء التزاوج ، تم نقل إناث الذباب إلى أنابيب إيبندورف وتجميدها في النيتروجين السائل بعد 40 دقيقة من TFM. ثم تم نقل الإناث إلى ثلاجة 80 درجة مئوية للتشريح في وقت لاحق.

يتم تخزين الحيوانات المنوية في الوعاء المنوي الأنثوي (SR) وحيواناتها المنوية المزدوجة (جيلوت ، 2005). الوقت المحدد الذي يبدأ فيه تخزين الحيوانات المنوية غير معروف D. simulans. في دراسة منفصلة قبل هذه التجربة ، حددنا الوقت الأمثل لعد الحيوانات المنوية في رحم الإناث قبل تخزينها في SR وحيوانات منوية للإناث (لم يتم تقديم البيانات). يفضل تعداد الحيوانات المنوية في الرحم بسبب الصعوبات المصاحبة لتشريح SR والحيوانات المنوية. احتوى الرحم على أكبر عدد من الحيوانات المنوية بعد 40 دقيقة من نهاية التزاوج. ومن ثم ، تم تجميد الإناث في النيتروجين السائل بعد 40 دقيقة من TFM في هذه التجربة.

إجراء تشريح وعد الحيوانات المنوية

تم إذابة تجميد إناث الذباب المجمدة في درجة حرارة الغرفة لمدة 10 دقائق على الأقل قبل التشريح حيث ساعد الجفاف على فصل حزم الحيوانات المنوية بشكل أفضل في الحيوانات المنوية الفردية. يقع الجهاز التناسلي الأنثوي في الجزء الخلفي البطني من البطن والرحم في النهاية الخلفية للجهاز التناسلي (Wilt & Hake ، 2003). تم استخدام محلول عازل الفوسفات (PBS) كوسيط أساسي للحفاظ على الحيوانات المنوية. تم pipetted 50 ميكرولتر من برنامج تلفزيوني على شريحة مجهرية. تم وضع الذبابة الأنثوية بجانب برنامج تلفزيوني تحت مجهر تشريح. تم ضغط الجسم برفق باستخدام ملاقط لإبراز قناة المبيض التي تم سحبها بملاقط دقيقة. تم وضع الرحم على الفور في برنامج تلفزيوني. تم استخدام إبر التشريح الدقيقة لقطع الأعضاء الدائرية في الطرف الأمامي للرحم. تم استخدام إبرة لإمساك الطرف الآخر من الجرح ، وباستخدام إبرة أخرى ، تم عصر الحيوانات المنوية. تمت إزالة الأجزاء الأنثوية وخلط الحيوانات المنوية مع برنامج تلفزيوني. تمت إضافة قسامة 50 ميكرولتر إضافية من برنامج تلفزيوني وخلطها. تُركت الشرائح لمدة 24 ساعة حتى تجف قبل غمرها في الماء منزوع الأيونات مرتين لمدة 10 ثوانٍ. تُركت الشرائح مغطاة بزاوية 45 درجة تقريبًا لمدة 24 ساعة أخرى. تم عد الحيوانات المنوية تحت المجال المظلم بتكبير 100 ×. تم حساب كل من حزم الحيوانات المنوية والحيوانات المنوية الفردية. كل حزمة تحتوي على 64 حيوان منوي (Snook وآخرون., 2000 ).

إحصائيات

تم استخدام anova المقاييس المتكررة للتحقيق في آثار عمر الذكور وتاريخ التزاوج على تحريض CI وتأثيرات حالة العدوى وعمر الذكور وتاريخ التزاوج على عدد الحيوانات المنوية المنقولة أثناء الجماع (انظر الجدول 1). تم تطبيق تصحيحات Bonferroni على جميع مقاييس التباين المتكررة للتحكم في المقارنات المتعددة. بالإضافة إلى ذلك ، تم إجراء تعديل على عدد درجات الحرية للأعمار في تجربة الحث CI بواسطة Greenhouse – Giesser بسبب كروية منتهكة (Greenhouse & Geisser ، 1959). تمت مقارنة تجانس المنحدرات بين علاجات تاريخ التزاوج بواسطة ancova في تجربة تحريض CI. يتم تقديم البيانات على أنها تعني ± SE. تم استخدام الإصدار 20 من SPSS لتحليل البيانات.


خيارات الوصول

احصل على حق الوصول الكامل إلى دفتر اليومية لمدة عام واحد

جميع الأسعار أسعار صافي.
سيتم إضافة ضريبة القيمة المضافة في وقت لاحق عند الخروج.
سيتم الانتهاء من حساب الضريبة أثناء الخروج.

احصل على وصول محدود أو كامل للمقالات على ReadCube.

جميع الأسعار أسعار صافي.


عمر الذكور و Wolbachia الديناميكيات: تحديد مدى سرعة ولماذا تختلف الكثافة البكتيرية وقوة عدم التوافق السيتوبلازمي

تكافلي داخلي Wolbachia تصيب البكتيريا مضيفات مفصليات الأرجل والديدان الخيطية المتباينة. تتسبب العديد من السلالات في عدم توافق السيتوبلازم (CI) الذي يقتل الأجنة غير المصابة المخصبة بواسطة Wolbachia- الحيوانات المنوية المعدلة. الأجنة المصابة محمية من CI ، وتعزيز Wolbachia ينتشر إلى ترددات توازن عالية متوازنة عن طريق انتقال غير كامل من الأم. تختلف قوة CI بشكل كبير في الطبيعة وتميل إلى الانخفاض مع تقدم عمر الذكور. يعد فهم أسباب تباين قوة CI أمرًا ضروريًا للتفسير Wolbachia انتشار في السكان المضيفين. هنا ، نتحرى مدى سرعة ولماذا تقل قوة CI مع عمر الذكور في نظامين نموذجيين: ثميل في ذبابة الفاكهة سوداء البطن و ثري في D. simulans. متوسط ثتقل قوة Mel CI بسرعة (19٪ / يوم) ، و ثتقل قوة Ri CI ببطء (6٪ / يوم) مع تقدم عمر الذكور ، وبالتالي ، في غضون ثلاثة أيام ، ثلا يسبب الذكور المصابون بالميل CI ، بينما يبلغ عمرهم اثني عشر يومًا ثلا يزال الذكور المصابون بالري يسببون ثباتًا بسيطًا ، ولكنه مهم. اختبرنا ما إذا كانت التخفيضات في Wolbachia يمكن أن تفسر الكثافات أو التعبير الجيني CI مع تقدم عمر الذكور هذا النمط. في الواقع، ثتنخفض كثافة Ri و CI في التعبير الجيني في الخصيتين مع تقدم عمر الذكور ، ولكن ثتزداد كثافة الميل والتعبير الجيني CI بشكل مدهش مع تقدم عمر الذكور مع انخفاض قوة CI. Phage WO lytic النشاط و ثرقم نسخة Mel Octomom - منطقة الجينات النبضية التي تؤثر ثتكاثر الميل - لا يفسر المعتمد على العمر Wolbachia كثافات. ومع ذلك ، فإن التعبير عن المذاق ، وهو جين أساسي في ذبابة الفاكهة مسار نقص المناعة ، يرتبط ارتباطًا وثيقًا ثكثافات الميل. معًا ، تشير هذه النتائج إلى أن الخصيتين على نطاق واسع Wolbachia الكثافة والتعبير الجيني CI غير كافيين لشرح قوة CI المعتمدة على العمر عبر السلالات وذاك Wolbachia تتأثر الكثافة بشكل متباين بعمر الذكور عبر Wolbachia- جمعيات المضيف. نحن نفترض أن مناعة المضيف قد تكمن وراء الاختلاف في ديناميات الكثافة المعتمدة على العمر. على نطاق أوسع ، فإن الانخفاض السريع في ثقوة ميل CI خلال الأسبوع الأول من D. melanogaster الحياة تساهم على الأرجح ثلوحظ تباين تردد ميل في عدة قارات.


تظهر هذه التجارب أنه بعد العلاج بالمضادات الحيوية لإزالة Wolbachia, N. giraulti و N. longicornis يمكن أن يتزاوج لينتج ذرية سليمة مع عدم وجود دليل على قابلية F1 / F2 للفتك أو العقم أو المرض الهجين. Wolbachiaيبدو أن عدم التوافق السيتوبلازمي الناتج عن السيتوبلازم قد سبق آليات العزل الأخرى. على الرغم من أن هذه التجارب تظهر درجة من العزلة الجزئية قبل التزاوج في اتجاه واحد ، فإن مساهمة Wolbachia يبدو أنه أهم حاجز بيولوجي أمام التهجين.

يمكن أن توفر العزلة الميكروبية قوة تطورية سريعة تتفوق على العناصر التقليدية للطفرة والانجراف الجيني. لكن بطبيعتها ، يكاد يكون من المستحيل إثبات النظريات التطورية ، وحتى الآن لا يوجد دليل يذكر على الأنواع المعدية في البرية. بدلاً من ذلك ، من المرجح أن تلعب ميزات مثل العزلة الجغرافية دورًا رئيسيًا. العوامل المؤهلة الأخرى التي تعمل على مستوى Wolbachia تشمل الطفيليات نفسها الاختلافات الطبيعية في نفاذ العدوى ونقلها ، وكلاهما يسمح بدرجة من تدفق الجينات بين السكان المضيفين. انتقال أفقي Wolbachia بين المضيفين سيعمل أيضًا على عكس تأثيرات عدم التوافق السيتوبلازمي. لكن نتائج هذه الدراسة في كل مكان Wolbachia تشير العدوى في الطبيعة إلى أن CI قد تعزز الانتواع بدلاً من دفعها مباشرة. لقد حددت الدراسات الجارية بالفعل بكتيريا أخرى قادرة على إحداث CI والتأثيرات البيولوجية المحتملة لمثل هذه العدوى يجب أن تصبح أكثر وضوحًا قريبًا.


مقدمة

الطفيليات التناسلية مثل البكتيريا داخل الخلايا Wolbachia التلاعب بالجهاز التناسلي لمضيفيهم لمصلحتهم الخاصة. اكثر شيوعا، Wolbachia يسبب عدم توافق الحيوانات المنوية والبويضة ، والمعروف باسم عدم التوافق السيتوبلازمي (انظر [1] ، [2] للاطلاع على المراجعات). بالتنسيق مع الحواجز الجغرافية أو الجينية لتدفق الجينات ، يمكن لمثل عدم التوافق السيتوبلازمي (CI) أن يعزز تطور العزلة الإنجابية ، وهو عنصر حاسم في الانتواع [3] - [6]. Wolbachia تنتشر على نطاق واسع في المفصليات ، مع تقدير 20٪ إلى 70٪ أنواع الحشرات المصابة بالبكتيريا [7] - [9]. ومن ثم ، فإن معالجة ما إذا كان Wolbachia يؤثر على عمليات الانتواع من مضيفيه هو سؤال مهم. هنا ، نتحرى من الناحية النظرية تأثير CI أحادي الاتجاه على الانتواع. يتماشى نهج النمذجة الخاص بنا مع الأدبيات النظرية حول كل من الانتواع من خلال التعزيز وغزو عوامل التزاوج (على سبيل المثال [10] - [13]).

عدم توافق السيتوبلازم (CI) هو عدم توافق التزاوج الناجم عن Wolbachia (انظر [14] للمراجعة). يطلق عليه بسبب السيتوبلازم Wolbachia ينتقل من الأم عبر سيتوبلازم البويضة إلى النسل. هناك نوعان من الأشكال الأساسية. يتضمن CI أحادي الاتجاه واحدًا Wolbachia أضنى. إذا أصيب الأب Wolbachia ثم يكون للتزاوج مع إناث غير مصابة (أو إناث مصابة بسلالة مختلفة) عدد أقل من الأبناء على قيد الحياة مقارنة بالتزاوج المحتمل الآخر. هذا بسبب عدم التوافق بين البويضة والحيوانات المنوية [15]. ثنائي الاتجاه CI ناتج عن اثنين Wolbachia سلالات ويمكن أن تحدث عندما يصاب شركاء التزاوج بسلالات مختلفة.

جذب عدم التوافق السيتوبلازمي الانتباه كآلية ممكنة للانتواع السريع [1] ، [3] ، [4] ، [6] ، [16] - [18]. الفكرة الأساسية هي أن CI تقلل تدفق الجينات بين السكان ، مما يسمح بالاختلاف الجيني واختيار العزلة المبكرة. في حالة ثنائية الاتجاه CI هناك أدلة تجريبية ونظرية تدعم هذا الرأي. تظهر الدراسات الميدانية أن العديد من أنواع الحشرات تأوي سلالات مختلفة من Wolbachia، غالبًا في مناطق جغرافية مختلفة [19] - [22]. علاوة على ذلك ، تشير التجارب المتقاطعة إلى أن CI ثنائي الاتجاه هو عامل عزل رئيسي بين بعض السلالات والأنواع وثيقة الصلة [4] ، [5] ، [17] ، [23] - [25]. من الناحية النظرية ، فقد ثبت أن اثنين Wolbachia يمكن أن تتعايش السلالات بشكل ثابت في مجموعات مضيفة نظيرة في مواجهة الهجرة الكبيرة [26] ، ويقلل هذا الثبات ثنائي الاتجاه من تدفق الجينات للأليلات المتكيفة محليًا ويختار العزل المسبق حتى لو كان انتقال Wolbachia ومستوى عدم التوافق غير كامل [6] ، [27] ، [28].

ومع ذلك ، فإن الرأي القائل Wolbachia تعتبر العوامل المهمة في انتواع المفصليات أمرًا مثيرًا للجدل [3] ، [18] ، [29] - [32]. الانتقادات الشائعة هي أن CI ثنائي الاتجاه (النمط الذي من الواضح أنه يمكن أن يعزز التخفيضات المتبادلة في تدفق الجينات) سيكون غير شائع في الطبيعة ، وأن مستويات CI غير كافية للسماح بالاختلاف الجيني ، وأن CI ليست فعالة في تعزيز تطور العزلة المسبقة .

من المحتمل أن يكون CI أحادي الاتجاه أكثر شيوعًا في الطبيعة ، لأنه يتطلب إصابة مجموعة واحدة فقط Wolbachia. ومع ذلك ، لا يُعتقد عمومًا أن CI أحادية الاتجاه تعزز الانتواع في العوائل لأن الحفاظ على السكان المصابين وغير المصابين من المتوقع أن يكون غير مستقر في وجود الهجرة. لذلك ، لن تستمر اختلافات CI وسيؤدي تدفق الجينات إلى القضاء على الاختلافات بين المجموعات السكانية المتباينة. أحد الأمثلة البارزة على عدم استقرار CI أحادي الاتجاه هو الانتشار السريع لـ Wolbachia في سيمولانس ذبابة الفاكهة كاليفورنيا [33]. ومع ذلك ، في دراسات ميدانية أخرى لوحظت عدوى مختلطة بين مجموعات من الأنواع [5] ، [34] ، [35]. مثال واحد هو عدم وجود Wolbachia في التجمعات الغازية من النمل الناري في أمريكا الشمالية ، ولكن وجود عدوى في مجموعات المصدر في أمريكا الجنوبية [5]. تم العثور على النمط العكسي أيضًا ، وجود Wolbachia موزعة عالميًا كوليكس بيبيينز لكن غيابه في مصدر سكان محتمل أصغر في جنوب إفريقيا [35]. علاوة على ذلك ، في تغذية الفطر ذبابة الفاكهة قد يكون CI أحادي الاتجاه بين الأنواع المصابة وغير المصابة ذات الصلة الوثيقة عاملًا رئيسيًا في العزلة الجينية [5] ، [36]. يبدو أن تعزيز العزلة الإنجابية يحدث في منطقة التلامس. تشير هذه الدراسات التجريبية إلى أن هناك حاجة إلى مزيد من النمذجة لديناميكيات CI أحادية الاتجاه ودورها المحتمل في تعزيز العزلة الإنجابية. السؤال الأساسي هو ما إذا كانت هناك ظروف يمكن بموجبها CI أحادي الاتجاه إنشاء نمط عدوى مستقر وما إذا كان هذا يختار الاختلاف الجيني والعزلة المبكرة. حتى الآن هناك دراسة نظرية واحدة تتناول هذا السؤال. فلور وآخرون. [37] أثبت بشكل تحليلي أن السكان المضيفين المصابين وغير المصابين يمكن أن يتعايشوا بشكل ثابت إذا كانت الهجرة أقل من معدل الهجرة الحرج. تبين أن معدل الهجرة الحرج إيجابي إذا Wolbachia يسبب إما انخفاض الخصوبة في العائل أو انتقاله غير مكتمل.

في هذه الدراسة نتحرى دور Wolbachia-الحث أحادي الاتجاه على انتواع العائل بشكل عام. ندرس أولاً الظروف التي تسمح بالحفاظ على اختلافات العدوى بين البر الرئيسي المصاب وسكان الجزيرة غير المصابين في البداية في ظل وجود هجرة أحادية الاتجاه والتكيف المحلي. ثم نتبع Telschow et al. [6] والجمع بين نماذج ل Wolbachia ديناميات [27] ، [38] مع نموذج تقوية مدروس جيدًا [13]. يسمح لنا هذا النموذج الجديد بالتحقيق في تأثير CI أحادي الاتجاه على الاختلاف الجيني للمضيف. نحن نعتبر أن الاختيار يعمل على مجموعة صغيرة (غير مصابة في البداية) من سكان الجزر الذين يعانون من الهجرة من سكان البر الرئيسي (المصابون) الكبير. يشتمل النموذج على موضع تفضيل الشريك ، وموضع سمة ذكورية يخضع لانتقاء متباين في المجموعتين ، وعدم توافق السيتوبلازم. في هذه الدراسة نظهر أن سكان الجزر منخفضة Wolbachia ترددات العدوى قادرة على الحفاظ على التكيف المحلي في مواجهة الهجرة بشكل أفضل من سكان الجزر المصابين بالعدوى. عند الجمع ، تكون الأليلات المتكيفة محليًا والاختلافات في العدوى مستقرتين عند معدلات هجرة أعلى من كلاهما لوحدهما. بالإضافة إلى ذلك ، فإن اختلاف العدوى بين البر الرئيسي والجزيرة يسمح للعزل المبكر بالتطور بسهولة أكبر. تشير النتائج إلى أنه في حالة حدوث مجموعات محيطية متكررة ، فإن تلك المجموعات هي التي تفقد Wolbachia التي من المرجح أن تتباعد إلى أنواع جديدة ، ويمكن أن يختار CI أحادي الاتجاه العزلة عن طريق تعزيز التمييز بين الشريك.


المواد والأساليب

تسلسل محاذاة والتنبؤ بالهيكل.

محاذاة تسلسل متعددة لأخصائيي تقويم العظام في CinB من عدة Wolbachia تم إنشاء سلالات ونوكليازات PD- (D / E) xK المعروفة باستخدام برنامج Cluster Omega Multiple Sequence Alignment من EMBL-EBI متبوعًا بالتعديل اليدوي (33). تم إجراء تنبؤات البنية الثانوية ومحاذاة تسلسل البروتين باستخدام برنامج PSIPRED لتحليل تسلسل البروتين (34). توقع هيكل CinB ثتم إجراء Pip باستخدام خادم RaptorX Structure Prediction مع إزالة عدد قليل من المناطق غير المهيكلة في الملحق SI، الشكل S1 (35).

مناعي غربي.

تم استخدام الأجسام المضادة التالية: الفأر المضاد لـ FLAG M2 (Sigma 1: 10000) ، الماوس 16B12 المضاد لـ HA (Covance 1: 1،000) ، الفأر المضاد لـ PGK (المجسات الجزيئية 1: 20000) ، وبيروكسيداز الفجل (HRP) المقترن مضاد للأغنام NA931V (GE Healthcare 1: 10،000). تم حل عينات البروتين بواسطة SDS / PAGE ونقلها إلى أغشية PVDF (Millipore) للتخثر المناعي. تم تصور البروتينات عن طريق التلألؤ الكيميائي القائم على HRP (36).

تنقية البروتينات لمقايسات نوكلياز في المختبر و ITC.

سينب كامل الطول ، متحولات سينب ​​غير نشطة تحفيزيًا (K279A ، K636A ، و KK279 / 636AA) ، CidB1–761(V686E / R688K) ، وتم التعبير عن CinA على أنها اندماج GST من ناقل pGEX6P1 في Rosetta DE3 (Novagen) بكتريا قولونية كما هو موضح سابقًا (9). لتقليل احتمالية تعاون CinB مع الحمض النووي ، استخدمنا بروتوكولًا لعزل البروتين الخالي من الحمض النووي الموصوف بواسطة Epling et al. (25) (الملحق SI, المواد والأساليب).

قياس السعرات الحرارية متساوي الحرارة.

تم إجراء تجارب مركز التجارة الدولية عند 25 درجة مئوية باستخدام NanoITC (أدوات TA). أولا ، CinA ثبيب وسينب ثتم غسيل الأنابيب على نطاق واسع مقابل المخزن المؤقت 50 ملي مولار Hepes (الرقم الهيدروجيني 7.4) على مدار 2 د مع 3 أو 4 تبادلات عازلة. لتحديد ألفة ربط CinB لـ CinA ، تم تحميل 500 ميكرومتر من CinA في حقنة ومعايرتها في محلول 50 ميكرومتر من CinB. تم إجراء ما مجموعه 22 حقنة (2 ميكرولتر لكل حقنة) على مدار التجربة مع تباعد 300 ثانية بين الحقن لضمان العودة إلى خط الأساس قبل الحقن التالي. تم تصحيح البيانات الأساسية باستخدام NITPIC وتحليلها في SEDPHAT باستخدام نموذج ربط موقع واحد (A + B → AB). تم تحضير الشكل 3 في GUSSI ، والذي تم تنزيله من صفحة برنامج MBR (http://biophysics.swmed.edu/MBR/software.html) (37 –39).

فحوصات نوكلياز.

تم إجراء جميع فحوصات نشاط نوكلياز المختبر باستخدام CinB كامل الطول ثالنقطة (البقايا من 1 إلى 733) مع أو بدون CinA ثالنقطة (المخلفات من 1 إلى 446). بالنسبة لمقايسات نشاط DNase و RNase ، تم تحضين 1 ميكرومتر من البروتينات الطافرة من CinB أو CinB في مخزن مؤقت للتفاعل يحتوي على 20 ملي مولار Hepes (درجة الحموضة 8.0) ، 5 ملي مولار MgCl2، 2.5 ٪ سكروز ، 150 ملي كلوريد الصوديوم ، 0.001 ٪ تريتون X-100 ، و 2 ملي مولار DTT مع 15 نانومتر إما خطي أو فائق الالتفاف pBluescript SK + ، 500 نانومتر أحادي أو مزدوج تقطعت بهم السبل DNA Cy5 [70-mer: Cy5- GCAATTCGATCGTTGACATCTCGCGTGCTCGGTCAATCGGCAGATGCGGAGTGAAGTTCCAACGTTCGGC-3 ، والتي كانت تستخدم سابقًا لتحليل انشقاق ssDNA (40 ، 41) 45-mer: Cy5-GGGTCAACGCAAGGAAGTAAGATGATGATGC ، التي تم اختبارها عبر الإنترنت ، والتي كان يجب أن يتم اختبارها على التوالي. لتوليد dsDNA] ، أو 500 نانوغرام من خميرة الحمض الريبي النووي النقال (Thermo Fisher) أو D. melanogaster مجموع الحمض النووي الريبي (40 ، 41). في التفاعلات التي كانت موجودة فيها CinA ، تم استخدام 10 ميكرومتر من CinA. تم إجراء جميع التفاعلات عند 25 درجة مئوية لمدة 90 دقيقة وإخمادها بإضافة EDTA إلى تركيز نهائي قدره 10 ملي مولار ما لم يذكر خلاف ذلك. بالنسبة للتفاعلات باستخدام ناقل pBluescript SK الخطي أو الدائري أو RNA ، تم تشغيل العينات في مواد هلامية agarose مع مجموعة من التركيزات بين 0.8 و 2.0 ٪ تحتوي على 0.4 ميكروغرام / مل من بروميد الإيثيديوم في 1 × TAE عازلة عند 100 فولت لمدة 40 إلى 60 دقيقة و تم تصويره على Syngene G: box مع برنامج GeneTools. بالنسبة للتفاعلات باستخدام oligodeoxynucleotides المسمى Cy5 ، تم تشغيل العينات في المواد الهلامية الأصلية بنسبة 9 ٪ TBE polyacrylamide عند 100 فولت لمدة 45 إلى 60 دقيقة وتم تصويرها على Typhoon FLA 7000 مع برنامج التحكم في Typhoon FLA 7000.

طرق الخميرة.

تم إجراء فحوصات نمو الخميرة الموضحة في سلالة BY4741 (42). يستخدم البلازميد 2 ميكرومتر pYES2 (URA3) GAL1 المروج و CYC1 المنهي وتم استخدامه لتعبير CinB الذي يحفزه الجالاكتوز في الخميرة. تم إجراء فحوصات نمو الخميرة والتكتل المناعي كما هو موضح سابقًا (9) (الملحق SI, المواد والأساليب).

ذبابة الفاكهة تحليلات معدل هاتش وعلم الخلايا.

كل جين مرشح CI (سينما, سينب, cinB-K636A، و سينما ايه- T2A- سينب) في ناقل pUASp-attB بواسطة تقنيات الاستنساخ القياسية دون تحسين الكودون. باختصار ، تم تضخيم ORFs للجينات بواسطة PCR واستنساخها في ناقل pBluescript SK + متبوعًا بتقييد الهضم وربط الجينات في ناقل pUASp-attB. تم التحقق من جميع البلازميدات عن طريق التسلسل الكامل للجينات المُدخلة قبل إرسالها إلى BestGene من أجل الحقن المجهري لـ D. melanogaster الأجنة (9). تم اختيار خلفية Fly 9744 لجميع التركيبات الجينية لتكامل attP / B الموجه بالموقع على الكروموسوم الثالث بواسطة PhiC31 Integrase (26) باستثناء أنه تم اختيار الخلفية 9723 للتكامل الخاص بالموقع لـ سينما على الكروموسوم الثاني. تم تأكيد التكامل بشكل مستقل عن طريق تضخيم PCR للجينات المرشحة (43 ، 44). D. melanogaster تم التحقق من أن المخزونات غير مصابة بالعدوى Wolbachia يعزل عن طريق تضخيم PCR من سيدا ثجين ميل (الملحق SI، الشكل S6). تم العثور على خط MTD-Gal4 من Bloomington Stock Center مصابًا ثتمت معالجة الميل بإضافة 20 ميكروغرام / مل من التتراسيكلين إلى وسط النمو لمدة 3 أجيال. بمجرد تأكيد العدوى لتطهيرها عن طريق تضخيم PCR لـ سيدا ثجين Mel ، تمت تربية الذباب على وسائط غير معالجة لمدة 3 أجيال إضافية على الأقل للسماح باستعادة الميتوكوندريا (45). كلاهما غير مصاب و ثغير مصاب D. simulans were also verified by PCR amplification of the cinB ثNo gene (الملحق SI, Fig. S6). Flies were reared on standard cornmeal-based solid media and maintained at room temperature. During virgin female collection, stocks were maintained at 18 °C overnight and room temperature the following day. All transgenic flies were maintained as homozygous lines.

Parental flies were generated by crossing either NGT-Gal4 or MTD-Gal4 virgin females with cin transgenic males (27, 29). Only the males emerging between 0 and 30 h from these crosses were collected and used in CI analyses (46). All flies used in both hatch-rate and cytological analyses were aged for 2 to 4 d. Hatch-rate analysis was performed and embryos for cytological analyses were prepared similarly as previously described (9, 10) (الملحق SI, المواد والأساليب). The samples were stained with either Hoechst 33342 at 1:1,000 in PBTA or 1 μg/mL propidium iodide (9, 10). Stained embryos were mounted on glass slides and sealed under coverslips by nail polish. Imaging was done either on a Zeiss Axioskop microscope with AxioCam MRm camera using 10× and 40× objective lenses or a Zeiss LSM 880 Airyscan/NLO confocal microscope with internal PMT using a 20× objective lens. Software used to capture and analyze the images were AxioVision Rel. 4.8 or Zen (blue edition), respectively.

Statistical Analyses.

All statistical analyses were done in GraphPad Prism 7. Hatch-rate analyses were performed by either using 1-way ANOVA with pairwise comparison after removal of outliers identified by the ROUT method with س = 1% (Fig. 5 ج و د) or unpaired 2-tailed Mann–Whitney يو test (Fig. 5ه و الملحق SI, Fig. S4). Pairwise χ 2 test was used in cytological analyses to compare normal and defect cytological phenotypes.

Data Availability.

Quantitative analyses for this study are provided in Dataset S1.


شاهد الفيديو: Mosquitoes Might Save Lives, Thanks To Bacteria. I Contain Multitudes (كانون الثاني 2022).